2.6　Lentivirus transfection

Lentiviruses with short hairpin RNA(shRNA)targeting ATG5(shRNA ATG5)and control shRNA(Misson p LK.1-puro Control vector)from the TRC shRNA libraries were purchased from Sigma-Aldrich.The ATG5 sequences are as follows：shRNA ATG5-1：5＇-CCGGGCCAAGTATCTGTCTATGATACTCGAGTATCATAGA C A GATACTTGGCTTTTTG-3＇；ATG5-2：5＇-CCGGCCTTGGAACATCACAGTACATC TCGAGATGTACTGTGATGTTCCAAGGTTTTTG-3＇；ATG5-3：5＇-CCGGGCAGAA CCATACTA TTTGCTTCTCGAGAAGCAAATAGTATGGTTCTGCTTT TTG-3＇.Lentiviruses were added to the third generation of primary cultured RAW264.7 cells and transfected for 72h.The transfection efficiency was 80%(data not shown)，and the silenced expression of ATG5 was confirmed by western blot analysis in RAW264.7 cells.(https://www.daowen.com)